src/test/TestReporter.java

Code
Comments
Other
Rev Date Author Line
597 16 May 05 samuel 1 /*
597 16 May 05 samuel 2   $Id$
597 16 May 05 samuel 3
3675 16 Aug 07 jari 4   Copyright (C) 2005 Samuel Andersson, Johan Enell, Nicklas Nordborg
4889 06 Apr 09 nicklas 5   Copyright (C) 2006 Johan Enell, Jari Häkkinen, Nicklas Nordborg
3675 16 Aug 07 jari 6   Copyright (C) 2007 Nicklas Nordborg
597 16 May 05 samuel 7
2304 22 May 06 jari 8   This file is part of BASE - BioArray Software Environment.
2304 22 May 06 jari 9   Available at http://base.thep.lu.se/
597 16 May 05 samuel 10
597 16 May 05 samuel 11   BASE is free software; you can redistribute it and/or
597 16 May 05 samuel 12   modify it under the terms of the GNU General Public License
4480 05 Sep 08 jari 13   as published by the Free Software Foundation; either version 3
597 16 May 05 samuel 14   of the License, or (at your option) any later version.
597 16 May 05 samuel 15
597 16 May 05 samuel 16   BASE is distributed in the hope that it will be useful,
597 16 May 05 samuel 17   but WITHOUT ANY WARRANTY; without even the implied warranty of
597 16 May 05 samuel 18   MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
597 16 May 05 samuel 19   GNU General Public License for more details.
597 16 May 05 samuel 20
597 16 May 05 samuel 21   You should have received a copy of the GNU General Public License
4514 11 Sep 08 jari 22   along with BASE. If not, see <http://www.gnu.org/licenses/>.
597 16 May 05 samuel 23 */
597 16 May 05 samuel 24 import net.sf.basedb.core.*;
597 16 May 05 samuel 25 import net.sf.basedb.core.data.ReporterData;
1135 25 Aug 05 nicklas 26 import net.sf.basedb.util.FileUtil;
2203 28 Apr 06 nicklas 27 import net.sf.basedb.util.parser.FlatFileParser;
597 16 May 05 samuel 28
1135 25 Aug 05 nicklas 29 import java.util.regex.Pattern;
597 16 May 05 samuel 30 import java.util.Date;
597 16 May 05 samuel 31
597 16 May 05 samuel 32 public class TestReporter
597 16 May 05 samuel 33 {
597 16 May 05 samuel 34   static boolean ok = true;
597 16 May 05 samuel 35
597 16 May 05 samuel 36   public static void main(String[] args)
597 16 May 05 samuel 37   {
597 16 May 05 samuel 38     TestUtil.checkArgs(args);
597 16 May 05 samuel 39     TestUtil.begin();
597 16 May 05 samuel 40     ok = test_all();
597 16 May 05 samuel 41     TestUtil.stop();
597 16 May 05 samuel 42   }
597 16 May 05 samuel 43
597 16 May 05 samuel 44   static boolean test_all()
597 16 May 05 samuel 45   {
597 16 May 05 samuel 46     write("++Testing reporter batching");
630 20 May 05 samuel 47     int rtId = TestReporterType.test_create();
639 23 May 05 samuel 48     test_create(50, rtId, 0, true);
639 23 May 05 samuel 49     test_create(50, rtId, 50, false);
671 27 May 05 samuel 50     test_update("Batchtest0");
597 16 May 05 samuel 51     write_header();
639 23 May 05 samuel 52     test_list(100);
640 24 May 05 samuel 53     test_externalId("Batchtest0");
1135 25 Aug 05 nicklas 54     
3626 03 Aug 07 nicklas 55     test_import_from_file("data/test.rawdata.import.txt", "\"Block\"\\t\"Column\"\\t\"Row\"\\t\"Name\"\\t\"ID\".*", "\\t", 4, 3);
1135 25 Aug 05 nicklas 56     
1529 27 Oct 05 nicklas 57     if (TestUtil.waitBeforeDelete()) TestUtil.waitForEnter();
597 16 May 05 samuel 58     test_delete();
630 20 May 05 samuel 59     TestReporterType.test_delete(rtId);
597 16 May 05 samuel 60     write("++Testing reporter batching "+(ok ? "OK" : "Failed")+"\n");
597 16 May 05 samuel 61     return ok;
597 16 May 05 samuel 62   }
597 16 May 05 samuel 63   
639 23 May 05 samuel 64   static void test_create(int nbr, int rtId, int startNbr, boolean setAll)
597 16 May 05 samuel 65   {
1135 25 Aug 05 nicklas 66     if (!TestUtil.hasPermission(Permission.CREATE, Item.REPORTER)) return;
597 16 May 05 samuel 67     write("--Start reporter batching(" + nbr + ")");
597 16 May 05 samuel 68     DbControl dc = null;
1122 24 Aug 05 nicklas 69     long time;
597 16 May 05 samuel 70     try
597 16 May 05 samuel 71     {
597 16 May 05 samuel 72       dc = TestUtil.getDbControl();
630 20 May 05 samuel 73       ReporterType rt = ReporterType.getById(dc, rtId);
597 16 May 05 samuel 74       ReporterBatcher rb = ReporterBatcher.getNew(dc);
630 20 May 05 samuel 75       
597 16 May 05 samuel 76       rb.setBatchSize(500);
639 23 May 05 samuel 77       int toNbr = nbr + startNbr;
1122 24 Aug 05 nicklas 78       time = System.currentTimeMillis();
639 23 May 05 samuel 79       for (int i = startNbr; i < toNbr; ++i)
597 16 May 05 samuel 80       {
1122 24 Aug 05 nicklas 81         ReporterData rd = Reporter.getNew("Batchtest" + i);
1122 24 Aug 05 nicklas 82         Reporter.setReporterType(rd, rt);
639 23 May 05 samuel 83         if (setAll)
639 23 May 05 samuel 84         {
639 23 May 05 samuel 85           rd.setName("Test reporter");
639 23 May 05 samuel 86           rd.setDescription("Added at "+new Date());
639 23 May 05 samuel 87           rd.setSymbol("Some_symbol");
639 23 May 05 samuel 88           rd.setExtended("species", "Homo Sapiens");
639 23 May 05 samuel 89           rd.setExtended("sequence", "atcatcgagaggaatgagacgtgacgtagg");
7516 02 Nov 18 nicklas 90           rd.setExtended("length", Integer.valueOf(30));
639 23 May 05 samuel 91         }
597 16 May 05 samuel 92         rb.insert(rd);
597 16 May 05 samuel 93       }
597 16 May 05 samuel 94       dc.commit();
1122 24 Aug 05 nicklas 95       time = System.currentTimeMillis()-time;
1122 24 Aug 05 nicklas 96       write("--Batching reporters OK (time="+time+" ms)");
597 16 May 05 samuel 97     }
597 16 May 05 samuel 98     catch (Throwable ex)
597 16 May 05 samuel 99     {
597 16 May 05 samuel 100       write("--Batching reporters FAILED");
597 16 May 05 samuel 101       ex.printStackTrace();
597 16 May 05 samuel 102       ok = false;
597 16 May 05 samuel 103     }
597 16 May 05 samuel 104     finally
597 16 May 05 samuel 105     {
597 16 May 05 samuel 106       if (dc != null) dc.close();
597 16 May 05 samuel 107     }
597 16 May 05 samuel 108   }
597 16 May 05 samuel 109
3633 06 Aug 07 nicklas 110   static boolean test_list(int expectedResults)
597 16 May 05 samuel 111   {
597 16 May 05 samuel 112     DbControl dc = null;
597 16 May 05 samuel 113     try
597 16 May 05 samuel 114     {
597 16 May 05 samuel 115       dc = TestUtil.getDbControl();
1418 07 Oct 05 nicklas 116       DataQuery<ReporterData> query = Reporter.getQuery();
1418 07 Oct 05 nicklas 117       DataResultIterator<ReporterData> it = query.iterate(dc);
597 16 May 05 samuel 118       int counter = 0;
597 16 May 05 samuel 119       while (it.hasNext())
597 16 May 05 samuel 120       {
630 20 May 05 samuel 121         write_item(dc, it.next());
597 16 May 05 samuel 122         ++counter;
597 16 May 05 samuel 123       }
597 16 May 05 samuel 124       if (expectedResults >= 0 && expectedResults != counter)
597 16 May 05 samuel 125       {
597 16 May 05 samuel 126         throw new BaseException("Expected "+expectedResults+" results, not "+counter);
597 16 May 05 samuel 127       }
597 16 May 05 samuel 128       write("--List reporters OK (" + counter + ")");
597 16 May 05 samuel 129     }
597 16 May 05 samuel 130     catch (Throwable ex)
597 16 May 05 samuel 131     {
597 16 May 05 samuel 132       write("--List reporters FAILED");
597 16 May 05 samuel 133       ex.printStackTrace();
597 16 May 05 samuel 134       ok = false;
3633 06 Aug 07 nicklas 135       return false;
597 16 May 05 samuel 136     }
597 16 May 05 samuel 137     finally
597 16 May 05 samuel 138     {
597 16 May 05 samuel 139       if (dc != null) dc.close();
597 16 May 05 samuel 140     }
3633 06 Aug 07 nicklas 141     return true;
597 16 May 05 samuel 142   }
640 24 May 05 samuel 143   
671 27 May 05 samuel 144   static void test_update(String externalId)
671 27 May 05 samuel 145   {
671 27 May 05 samuel 146     DbControl dc = null;
671 27 May 05 samuel 147     try
671 27 May 05 samuel 148     {
671 27 May 05 samuel 149       dc = TestUtil.getDbControl();
671 27 May 05 samuel 150       ReporterBatcher rb = ReporterBatcher.getNew(dc);
671 27 May 05 samuel 151       ReporterData rd = Reporter.getByExternalId(dc, externalId);
671 27 May 05 samuel 152       rd.setExtended("species", "Mus Musculus");
671 27 May 05 samuel 153       rb.update(rd);
671 27 May 05 samuel 154       dc.commit();
671 27 May 05 samuel 155       write("--Update by external id OK");
671 27 May 05 samuel 156     }
671 27 May 05 samuel 157     catch (Throwable ex)
671 27 May 05 samuel 158     {
671 27 May 05 samuel 159       write("--Update by external id FAILED");
671 27 May 05 samuel 160       ex.printStackTrace();
671 27 May 05 samuel 161       ok = false;
671 27 May 05 samuel 162     }
671 27 May 05 samuel 163     finally
671 27 May 05 samuel 164     {
671 27 May 05 samuel 165       if (dc != null) dc.close();
671 27 May 05 samuel 166     }
671 27 May 05 samuel 167   }
671 27 May 05 samuel 168   
3468 08 Jun 07 nicklas 169   static int test_externalId(String externalId)
640 24 May 05 samuel 170   {
640 24 May 05 samuel 171     DbControl dc = null;
3468 08 Jun 07 nicklas 172     int id = 0;
640 24 May 05 samuel 173     try
640 24 May 05 samuel 174     {
640 24 May 05 samuel 175       dc = TestUtil.getDbControl();
640 24 May 05 samuel 176       ReporterData rd = Reporter.getByExternalId(dc, externalId);
3468 08 Jun 07 nicklas 177       id = rd.getId();
640 24 May 05 samuel 178       write_item(dc, rd);
640 24 May 05 samuel 179       write("--Get by external id OK");
640 24 May 05 samuel 180     }
640 24 May 05 samuel 181     catch (Throwable ex)
640 24 May 05 samuel 182     {
640 24 May 05 samuel 183       write("--Get by external id FAILED");
640 24 May 05 samuel 184       ex.printStackTrace();
640 24 May 05 samuel 185       ok = false;
640 24 May 05 samuel 186     }
640 24 May 05 samuel 187     finally
640 24 May 05 samuel 188     {
640 24 May 05 samuel 189       if (dc != null) dc.close();
640 24 May 05 samuel 190     }
3468 08 Jun 07 nicklas 191     return id;
640 24 May 05 samuel 192   }
597 16 May 05 samuel 193
597 16 May 05 samuel 194   static void test_delete()
597 16 May 05 samuel 195   {
597 16 May 05 samuel 196     DbControl dc = null;
597 16 May 05 samuel 197     try
597 16 May 05 samuel 198     {
597 16 May 05 samuel 199       dc = TestUtil.getDbControl();
597 16 May 05 samuel 200       ReporterBatcher rb = ReporterBatcher.getNew(dc);
1418 07 Oct 05 nicklas 201       DataQuery<ReporterData> query = Reporter.getQuery();
1418 07 Oct 05 nicklas 202       DataResultIterator<ReporterData> it = query.iterate(dc);
597 16 May 05 samuel 203       while (it.hasNext())
597 16 May 05 samuel 204       {
597 16 May 05 samuel 205         rb.delete(it.next());
597 16 May 05 samuel 206       }
597 16 May 05 samuel 207       dc.commit();
597 16 May 05 samuel 208       write("--Delete reporters OK");
597 16 May 05 samuel 209     }
597 16 May 05 samuel 210     catch (Throwable ex)
597 16 May 05 samuel 211     {
597 16 May 05 samuel 212       write("--Delete reporters FAILED");
597 16 May 05 samuel 213       ex.printStackTrace();
597 16 May 05 samuel 214       ok = false;
597 16 May 05 samuel 215     }
597 16 May 05 samuel 216     finally
597 16 May 05 samuel 217     {
597 16 May 05 samuel 218       if (dc != null) dc.close();
597 16 May 05 samuel 219     }
597 16 May 05 samuel 220   }
597 16 May 05 samuel 221
597 16 May 05 samuel 222   static void write_header()
597 16 May 05 samuel 223   {
597 16 May 05 samuel 224     if (!TestUtil.getSilent())
597 16 May 05 samuel 225     {
1293 08 Sep 05 nicklas 226       write("ID \tExternal ID\tName      \tDescription  \tSymbol    \tLast update   \tCluster ID  \tReporter type");
640 24 May 05 samuel 227       write("-- \t-----------\t--------- \t-------------\t----------\t--------------\t---------\t-------------");
597 16 May 05 samuel 228     }
597 16 May 05 samuel 229   }
630 20 May 05 samuel 230   static void write_item(DbControl dc, ReporterData rd)
597 16 May 05 samuel 231     throws BaseException
597 16 May 05 samuel 232   {
640 24 May 05 samuel 233     if (!TestUtil.getSilent()) System.out.println(rd.getId()+"\t"+rd.getExternalId()+"\t"+rd.getName()+"\t"+rd.getDescription()+
1293 08 Sep 05 nicklas 234       "\t"+rd.getSymbol()+"\t"+rd.getLastUpdate()+"\t"+rd.getExtended("clusterId")+"\t"+Reporter.getReporterType(dc, rd));
597 16 May 05 samuel 235   }
597 16 May 05 samuel 236   static void write(String message)
597 16 May 05 samuel 237   {
597 16 May 05 samuel 238     System.out.println(message);
597 16 May 05 samuel 239   }
1135 25 Aug 05 nicklas 240   
3626 03 Aug 07 nicklas 241   static void test_import_from_file(String filename, String headerRegexp, String splitterRegexp, int idCol, int nameCol)
1135 25 Aug 05 nicklas 242   {
1135 25 Aug 05 nicklas 243     if (!TestUtil.hasPermission(Permission.CREATE, Item.REPORTER)) return;
1135 25 Aug 05 nicklas 244     write("--Start import reporters from file (" + filename + ")");
1135 25 Aug 05 nicklas 245     DbControl dc = null;
1135 25 Aug 05 nicklas 246     long time;
1135 25 Aug 05 nicklas 247     int i = 0;
1135 25 Aug 05 nicklas 248     try
1135 25 Aug 05 nicklas 249     {
1135 25 Aug 05 nicklas 250       dc = TestUtil.getDbControl();
1135 25 Aug 05 nicklas 251
1135 25 Aug 05 nicklas 252       FlatFileParser ffp = new FlatFileParser();
1143 29 Aug 05 nicklas 253       ffp.setDataHeaderRegexp(Pattern.compile(headerRegexp));
3626 03 Aug 07 nicklas 254       ffp.setDataSplitterRegexp(Pattern.compile(splitterRegexp));
2992 01 Dec 06 enell 255       ffp.setInputStream(FileUtil.getInputStream(new java.io.File(filename)), "ISO-8859-1");
1135 25 Aug 05 nicklas 256       ffp.parseHeaders();
1135 25 Aug 05 nicklas 257       ReporterBatcher rb = ReporterBatcher.getNew(dc);
1135 25 Aug 05 nicklas 258       time = System.currentTimeMillis();
1135 25 Aug 05 nicklas 259       while (ffp.hasMoreData())
1135 25 Aug 05 nicklas 260       {
1135 25 Aug 05 nicklas 261         FlatFileParser.Data data = ffp.nextData();
7665 20 Mar 19 nicklas 262         String externalId = data.getString(idCol);
7665 20 Mar 19 nicklas 263         String name = data.getString(nameCol);
1594 14 Nov 05 nicklas 264         if (name == null) name = externalId;
1594 14 Nov 05 nicklas 265         if (externalId != null && !rb.exists(externalId, true, true))
1135 25 Aug 05 nicklas 266         {
1143 29 Aug 05 nicklas 267           ReporterData r = Reporter.getNew(externalId);
1594 14 Nov 05 nicklas 268           r.setName(name);
1135 25 Aug 05 nicklas 269           rb.insert(r);
1135 25 Aug 05 nicklas 270           i++;
1135 25 Aug 05 nicklas 271         }
1135 25 Aug 05 nicklas 272       }
1135 25 Aug 05 nicklas 273       dc.commit();
1135 25 Aug 05 nicklas 274       time = System.currentTimeMillis()-time;
1135 25 Aug 05 nicklas 275       write("--Import reporters from file OK ("+i+", time="+time+" ms)");
1135 25 Aug 05 nicklas 276     }
1135 25 Aug 05 nicklas 277     catch (Throwable ex)
1135 25 Aug 05 nicklas 278     {
1135 25 Aug 05 nicklas 279       write("--Import reporters from file FAILED ("+i+")");
1135 25 Aug 05 nicklas 280       ex.printStackTrace();
1135 25 Aug 05 nicklas 281       ok = false;
1135 25 Aug 05 nicklas 282     }
1135 25 Aug 05 nicklas 283     finally
1135 25 Aug 05 nicklas 284     {
1135 25 Aug 05 nicklas 285       if (dc != null) dc.close();
1135 25 Aug 05 nicklas 286     }
1135 25 Aug 05 nicklas 287
1135 25 Aug 05 nicklas 288   }
1135 25 Aug 05 nicklas 289   
597 16 May 05 samuel 290 }
597 16 May 05 samuel 291

Generated on Sat Oct  7 02:42:04 2023 (UTC) by svndigest 0.11.2pre (dev build 1672)